← All skills

biopython

utility

Molecular biology toolkit with Biopython — sequence manipulation, FASTA/GenBank/PDB parsing, phylogenetics, BLAST automation, and programmatic NCBI/PubMed access via Bio.Entrez.

Biopython: Computational Molecular Biology in Python

Overview

Biopython is a comprehensive set of freely available Python tools for biological computation. It provides functionality for sequence manipulation, file I/O, database access, structural bioinformatics, phylogenetics, and many other bioinformatics tasks. The current version is Biopython 1.88 (released 6 August 2026). It supports Python 3.10-3.14 plus the Python 3.15 release candidate, and PyPy3.10, and requires NumPy; upstream support for Python 3.10 is now deprecated as that version approaches end of life.

Two recent releases were driven by security fixes, and both matter for the parsing workflows below:

  • 1.88 hardens the Bio.Nexus NEXUS parser. Up to 1.87 it read the ntax and nchar values out of the file and passed them to Python's built-in eval, so those fields were executable and a crafted file could run arbitrary code at parse time. Both call sites are gone in 1.88. Bio.Phylo and Bio.AlignIO share this parser, so the exposure is not limited to code that imports Bio.Nexus directly.
  • 1.87 addressed CVE-2025-68463 in Bio.Entrez.Parser when parsing untrusted files.

Prefer 1.88+ for any workflow that parses NEXUS or Entrez XML it did not produce itself.

When to Use This Skill

Use this skill when:

  • Working with biological sequences (DNA, RNA, or protein)
  • Reading, writing, or converting biological file formats (FASTA, GenBank, FASTQ, PDB, mmCIF, etc.)
  • Accessing NCBI databases (GenBank, PubMed, Protein, Gene, etc.) via Entrez
  • Running BLAST searches or parsing BLAST results
  • Performing sequence alignments (pairwise or multiple sequence alignments)
  • Analyzing protein structures from PDB files
  • Creating, manipulating, or visualizing phylogenetic trees
  • Finding sequence motifs or analyzing motif patterns
  • Calculating sequence statistics (GC content, molecular weight, melting temperature, etc.)
  • Performing structural bioinformatics tasks
  • Working with population genetics data
  • Any other computational molecular biology task

Core Capabilities

Biopython is organized into modular sub-packages, each addressing specific bioinformatics domains:

  1. Sequence Handling - Bio.Seq and Bio.SeqIO for sequence manipulation and file I/O
  2. Alignment Analysis - Bio.Align and Bio.AlignIO for pairwise and multiple sequence alignments
  3. Database Access - Bio.Entrez for programmatic access to NCBI databases
  4. BLAST Operations - Bio.Blast for running and parsing BLAST searches
  5. Structural Bioinformatics - Bio.PDB for working with 3D protein structures
  6. Phylogenetics - Bio.Phylo for phylogenetic tree manipulation and visualization
  7. Advanced Features - Motifs, population genetics, sequence utilities, and more

Installation and Setup

Install the current stable Biopython release with an explicit version pin for reproducibility:

uv pip install "biopython==1.88"

For NCBI database access, always set your email address (required by NCBI). For reusable software, set a stable Entrez.tool value and register the tool/email with NCBI. For higher rate limits (10 req/s instead of 3 req/s), read only NCBI_API_KEY from the environment — do not hardcode keys or load unrelated environment variables:

import os
from Bio import Entrez

Entrez.email = "your.email@example.com"  # required — use your real email
Entrez.tool = "your_tool_name"  # optional but recommended for reusable software

# Optional: register at https://www.ncbi.nlm.nih.gov/account/settings/
if api_key := os.environ.get("NCBI_API_KEY"):
    Entrez.api_key = api_key

Using This Skill

This skill provides comprehensive documentation organized by functionality area. When working on a task, consult the relevant reference documentation:

1. Sequence Handling (Bio.Seq & Bio.SeqIO)

Reference: references/sequence_io.md

Use for:

  • Creating and manipulating biological sequences
  • Reading and writing sequence files (FASTA, GenBank, FASTQ, etc.)
  • Converting between file formats
  • Extracting sequences from large files
  • Sequence translation, transcription, and reverse complement
  • Working with SeqRecord objects

Quick example:

from Bio import SeqIO

# Read sequences from FASTA file
for record in SeqIO.parse("sequences.fasta", "fasta"):
    print(f"{record.id}: {len(record.seq)} bp")

# Convert GenBank to FASTA
SeqIO.convert("input.gb", "genbank", "output.fasta", "fasta")

2. Alignment Analysis (Bio.Align & Bio.AlignIO)

Reference: references/alignment.md

Use for:

  • Pairwise sequence alignment (global and local)
  • Reading and writing multiple sequence alignments
  • Using substitution matrices (BLOSUM, PAM)
  • Calculating alignment statistics
  • Customizing alignment parameters

Quick example:

from Bio import Align

# Pairwise alignment
aligner = Align.PairwiseAligner()
aligner.mode = 'global'
alignments = aligner.align("ACCGGT", "ACGGT")
print(alignments[0])

3. Database Access (Bio.Entrez)

Reference: references/databases.md

Use for:

  • Searching NCBI databases (PubMed, GenBank, Protein, Gene, etc.)
  • Downloading sequences and records
  • Fetching publication information
  • Finding related records across databases
  • Batch downloading with proper rate limiting

Quick example:

from Bio import Entrez
Entrez.email = "your.email@example.com"

# Search PubMed
handle = Entrez.esearch(db="pubmed", term="biopython", retmax=10)
results = Entrez.read(handle)
handle.close()
print(f"Found {results['Count']} results")

4. BLAST Operations (Bio.Blast)

Reference: references/blast.md

Use for:

  • Running BLAST searches via NCBI web services
  • Running local BLAST searches
  • Parsing BLAST XML output
  • Filtering results by E-value or identity
  • Extracting hit sequences

Quick example:

from Bio.Blast import NCBIWWW, NCBIXML

# Run BLAST search
result_handle = NCBIWWW.qblast("blastn", "nt", "ATCGATCGATCG")
blast_record = NCBIXML.read(result_handle)

# Display top hits
for alignment in blast_record.alignments[:5]:
    print(f"{alignment.title}: E-value={alignment.hsps[0].expect}")

5. Structural Bioinformatics (Bio.PDB)

Reference: references/structure.md

Use for:

  • Parsing PDB and mmCIF structure files
  • Navigating protein structure hierarchy (SMCRA: Structure/Model/Chain/Residue/Atom)
  • Calculating distances, angles, and dihedrals
  • Secondary structure assignment (DSSP)
  • Structure superimposition and RMSD calculation
  • Extracting sequences from structures

Quick example:

from Bio.PDB import PDBParser

# Parse structure
parser = PDBParser(QUIET=True)
structure = parser.get_structure("1crn", "1crn.pdb")

# Calculate distance between alpha carbons
chain = structure[0]["A"]
distance = chain[10]["CA"] - chain[20]["CA"]
print(f"Distance: {distance:.2f} Å")

6. Phylogenetics (Bio.Phylo)

Reference: references/phylogenetics.md

Use for:

  • Reading and writing phylogenetic trees (Newick, NEXUS, phyloXML)
  • Building trees from distance matrices or alignments
  • Tree manipulation (pruning, rerooting, ladderizing)
  • Calculating phylogenetic distances
  • Creating consensus trees
  • Visualizing trees

Quick example:

from Bio import Phylo

# Read and visualize tree
tree = Phylo.read("tree.nwk", "newick")
Phylo.draw_ascii(tree)

# Calculate distance
distance = tree.distance("Species_A", "Species_B")
print(f"Distance: {distance:.3f}")

7. Advanced Features

Reference: references/advanced.md

Use for:

  • Sequence motifs (Bio.motifs) - Finding and analyzing motif patterns
  • Population genetics (Bio.PopGen) - GenePop files, Fst calculations, Hardy-Weinberg tests
  • Sequence utilities (Bio.SeqUtils) - GC content, melting temperature, molecular weight, protein analysis
  • Restriction analysis (Bio.Restriction) - Finding restriction enzyme sites
  • Clustering (Bio.Cluster) - K-means and hierarchical clustering
  • Genome diagrams (GenomeDiagram) - Visualizing genomic features

Quick example:

from Bio.SeqUtils import gc_fraction, molecular_weight
from Bio.Seq import Seq

seq = Seq("ATCGATCGATCG")
print(f"GC content: {gc_fraction(seq):.2%}")
print(f"Molecular weight: {molecular_weight(seq, seq_type='DNA'):.2f} g/mol")

General Workflow Guidelines

Reading Documentation

When a user asks about a specific Biopython task:

  1. Identify the relevant module based on the task description
  2. Read the appropriate reference file using the Read tool
  3. Extract relevant code patterns and adapt them to the user's specific needs
  4. Combine multiple modules when the task requires it

Example search patterns for reference files:

# Find information about specific functions
rg -n "SeqIO.parse" references/sequence_io.md

# Find examples of specific tasks
rg -n "BLAST" references/blast.md

# Find information about specific concepts
rg -n "alignment" references/alignment.md

Writing Biopython Code

Follow these principles when writing Biopython code:

  1. Import modules explicitly

    from Bio import SeqIO, Entrez
    from Bio.Seq import Seq
    
  2. Set Entrez email when using NCBI databases; load only NCBI_API_KEY from the environment if present

    import os
    from Bio import Entrez
    
    Entrez.email = "your.email@example.com"
    Entrez.tool = "your_tool_name"
    if api_key := os.environ.get("NCBI_API_KEY"):
        Entrez.api_key = api_key
    
  3. Use appropriate file formats - Check which format best suits the task

    # Common formats: "fasta", "genbank", "fastq", "clustal", "phylip"
    
  4. Handle files properly - Close handles after use or use context managers

    with open("file.fasta") as handle:
        records = SeqIO.parse(handle, "fasta")
    
  5. Use iterators for large files - Avoid loading everything into memory

    for record in SeqIO.parse("large_file.fasta", "fasta"):
        # Process one record at a time
        print(record.id, len(record.seq))
    
  6. Handle errors gracefully - Network operations and file parsing can fail

    from urllib.error import HTTPError
    
    try:
        handle = Entrez.efetch(db="nucleotide", id=accession)
    except HTTPError as e:
        print(f"Error: {e}")
    

Common Patterns

Pattern 1: Fetch Sequence from GenBank

from Bio import Entrez, SeqIO

Entrez.email = "your.email@example.com"

# Fetch sequence
handle = Entrez.efetch(db="nucleotide", id="EU490707", rettype="gb", retmode="text")
record = SeqIO.read(handle, "genbank")
handle.close()

print(f"Description: {record.description}")
print(f"Sequence length: {len(record.seq)}")

Pattern 2: Sequence Analysis Pipeline

from Bio import SeqIO
from Bio.SeqUtils import gc_fraction

for record in SeqIO.parse("sequences.fasta", "fasta"):
    # Calculate statistics
    gc = gc_fraction(record.seq)
    length = len(record.seq)

    # Find ORFs, translate, etc.
    protein = record.seq.translate()

    print(f"{record.id}: {length} bp, GC={gc:.2%}")

Pattern 3: BLAST and Fetch Top Hits

from Bio.Blast import NCBIWWW, NCBIXML
from Bio import Entrez, SeqIO

Entrez.email = "your.email@example.com"

# Run BLAST
result_handle = NCBIWWW.qblast("blastn", "nt", sequence)
blast_record = NCBIXML.read(result_handle)

# Get top hit accessions
accessions = [aln.accession for aln in blast_record.alignments[:5]]

# Fetch sequences
for acc in accessions:
    handle = Entrez.efetch(db="nucleotide", id=acc, rettype="fasta", retmode="text")
    record = SeqIO.read(handle, "fasta")
    handle.close()
    print(f">{record.description}")

Pattern 4: Build Phylogenetic Tree from Sequences

from Bio import AlignIO, Phylo
from Bio.Phylo.TreeConstruction import DistanceCalculator, DistanceTreeConstructor

# Read alignment
alignment = AlignIO.read("alignment.fasta", "fasta")

# Calculate distances
calculator = DistanceCalculator("identity")
dm = calculator.get_distance(alignment)

# Build tree
constructor = DistanceTreeConstructor()
tree = constructor.nj(dm)

# Visualize
Phylo.draw_ascii(tree)

Best Practices

  1. Always read relevant reference documentation before writing code
  2. Use grep to search reference files for specific functions or examples
  3. Validate file formats before parsing
  4. Handle missing data gracefully - Not all records have all fields
  5. Cache downloaded data - Don't repeatedly download the same sequences
  6. Respect NCBI rate limits - Use API keys, registered tool/email values for reusable software, and Entrez history/batching for large jobs
  7. Test with small datasets before processing large files
  8. Keep Biopython updated to get the latest features, bug fixes, and security fixes — 1.87 and 1.88 were both driven by parser vulnerabilities
  9. Use appropriate genetic code tables for translation
  10. Document analysis parameters for reproducibility

Troubleshooting Common Issues

Issue: "No handlers could be found for logger 'Bio.Entrez'"

Solution: This is just a warning. Set Entrez.email to suppress it.

Issue: "HTTP Error 400" from NCBI

Solution: Check that IDs/accessions are valid and properly formatted.

Issue: "ValueError: EOF" when parsing files

Solution: Verify file format matches the specified format string.

Issue: Alignment fails with "sequences are not the same length"

Solution: Ensure sequences are aligned before using AlignIO or MultipleSeqAlignment.

Issue: BLAST searches are slow

Solution: Use local BLAST for large-scale searches, or cache results.

Issue: PDB parser warnings

Solution: Use PDBParser(QUIET=True) to suppress warnings, or investigate structure quality.

Issue: Bio.MarkovModel and Bio.Application raise ModuleNotFoundError, and Bio.HMM imports but is empty

Solution: The functionality was removed in Biopython 1.86. Use hmmlearn for HMMs and the standard library subprocess module instead of Bio.Application CLI wrappers.

Bio.MarkovModel and Bio.Application are gone outright, so importing either raises ModuleNotFoundError. Bio.HMM is the one that misleads: as of 1.88 it is still installed as a package containing nothing but its own docstring, so import Bio.HMM succeeds and an availability check written that way reports the module as present. Every submodule that did the work — Bio.HMM.MarkovModel, Bio.HMM.Trainer, Bio.HMM.Utilities, Bio.HMM.DynamicProgramming — raises ModuleNotFoundError. Test for what you actually call, not for the package.

Issue: Reading a NEXUS file from a source you do not control

Solution: Use Biopython 1.88 or later. Up to 1.87 the NEXUS parser passed the file's own ntax and nchar fields to Python's built-in eval, so reading a crafted file could run arbitrary code. Every NEXUS entry point shares that parser — Phylo.read(path, "nexus"), AlignIO.read(path, "nexus") and Bio.Nexus.Nexus alike — so upgrading, rather than switching entry point, is the fix.

Issue: PairwiseAligner returns fewer alignments after upgrading to 1.86+

Solution: The default gap score changed from 0 to -1 in 1.86, so a gap no longer ties with a mismatch and the trivial tie alignments disappear. It bites only where a gap competes with a mismatch: AAGAA against AACAA returns 1 alignment where it used to return 3. On a pair differing by a plain insertion it changes nothing — ACCGGT against ACGGT returns 2 alignments under either setting, which is why testing this on the usual tutorial pair suggests the change never happened. Set aligner.gap_score = 0 to restore the old behavior if needed (see references/alignment.md).

Try it

A self-contained check that this skill still works. No network, no account, no downloads — the block writes its own input, so it runs anywhere Biopython is installed.

Data — generated inline, which is why datasets: is empty. The block writes three short sequences to demo.fasta and reads them back. AAGAA and AACAA are the pair that matters: they differ at a single position, which is the only situation where the alignment default that changed in 1.86 changes how many alignments come back. Nothing public needs to be fetched to exercise this, and depending on a remote sequence file would make the check fail for reasons that have nothing to do with Biopython.

Run

from Bio import Align, SeqIO
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio.SeqUtils import gc_fraction

# --- data: written here, nothing fetched -------------------------------------
records = [
    SeqRecord(Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"), id="seq1", description=""),
    SeqRecord(Seq("AAGAA"), id="seq2", description=""),
    SeqRecord(Seq("AACAA"), id="seq3", description=""),
]
SeqIO.write(records, "demo.fasta", "fasta")
parsed = {r.id: r.seq for r in SeqIO.parse("demo.fasta", "fasta")}
print(f"parsed {len(parsed)} records: {sorted(parsed)}")

# --- sequence basics ---------------------------------------------------------
cds = parsed["seq1"]
print(f"gc_fraction = {gc_fraction(cds):.4f}")
print(f"translate   = {cds.translate()}")
print(f"to_stop     = {cds.translate(to_stop=True)}")

# --- the trap: the gap-score default changed in 1.86 -------------------------
target, query = str(parsed["seq2"]), str(parsed["seq3"])

current = Align.PairwiseAligner(mode="global")
legacy = Align.PairwiseAligner(mode="global")
legacy.gap_score = 0  # the pre-1.86 default

now, before = current.align(target, query), legacy.align(target, query)
print(f"default gap_score = {current.gap_score}")
print(f"{target}/{query}: {len(now)} alignment(s) now, {len(before)} at gap_score=0")
print(f"scores: {now.score} and {before.score}")

# the same comparison on the pair this skill uses as its quick example
a, b = Align.PairwiseAligner(mode="global"), Align.PairwiseAligner(mode="global")
b.gap_score = 0
print(f"ACCGGT/ACGGT: {len(a.align('ACCGGT', 'ACGGT'))} alignment(s) now, "
      f"{len(b.align('ACCGGT', 'ACGGT'))} at gap_score=0")

# --- invariants --------------------------------------------------------------
assert len(cds) % 3 == 0 and len(cds.translate()) == len(cds) // 3
assert 0.0 <= gc_fraction(cds) <= 1.0
assert current.gap_score == -1.0
assert len(now) < len(before)
assert now.score == before.score
print("OK")

Expect

Invariants — these hold across versions, and a failure means the skill is wrong:

  • One amino acid per complete codon: a 39-nt CDS gives 13 residues. to_stop=True truncates at the first stop rather than dropping the stop symbols from the middle.
  • gc_fraction returns a fraction in 0–1, not a percentage. The :.2% format used in Pattern 2 above is what turns it into one; printing it raw and calling it a percentage is the mistake this asserts against.
  • SeqIO.parse yields each record once — it is an iterator, not a list.
  • Where a mismatch and a pair of gaps score equally, gap_score = 0 keeps all of them and the current default keeps only the ungapped one. That survivor has no gaps, so its score is the same under both settings. Where the best alignment does contain gaps, the −1 default instead lowers its score by one per gap character and leaves the count alone.

Observed 2026-08-27 against Biopython 1.88 / Python 3.11.15 — treat a mismatch here as drift to investigate, not as a failure:

parsed 3 records: ['seq1', 'seq2', 'seq3']
gc_fraction = 0.5641
translate   = MAIVMGR*KGAR*
to_stop     = MAIVMGR
default gap_score = -1.0
AAGAA/AACAA: 1 alignment(s) now, 3 at gap_score=0
scores: 4.0 and 4.0
ACCGGT/ACGGT: 2 alignment(s) now, 2 at gap_score=0
OK

The last line is the part worth keeping. ACCGGT/ACGGT — the pair used as this skill's own pairwise example, and the one in most tutorials — returns 2 alignments either way, so testing the 1.86 change on it suggests the change never happened.

Additional Resources

Quick Reference

To locate information in reference files, use these search patterns:

# Search for specific functions
rg -n "function_name" references/*.md

# Find examples of specific tasks
rg -n "example" references/sequence_io.md

# Find all occurrences of a module
rg -n "Bio.Seq" references/*.md

Summary

Biopython provides comprehensive tools for computational molecular biology. When using this skill:

  1. Identify the task domain (sequences, alignments, databases, BLAST, structures, phylogenetics, or advanced)
  2. Consult the appropriate reference file in the references/ directory
  3. Adapt code examples to the specific use case
  4. Combine multiple modules when needed for complex workflows
  5. Follow best practices for file handling, error checking, and data management

The modular reference documentation ensures detailed, searchable information for every major Biopython capability.