biopython
utilityMolecular biology toolkit with Biopython — sequence manipulation, FASTA/GenBank/PDB parsing, phylogenetics, BLAST automation, and programmatic NCBI/PubMed access via Bio.Entrez.
Biopython: Computational Molecular Biology in Python
Overview
Biopython is a comprehensive set of freely available Python tools for biological computation. It provides functionality for sequence manipulation, file I/O, database access, structural bioinformatics, phylogenetics, and many other bioinformatics tasks. The current version is Biopython 1.88 (released 6 August 2026). It supports Python 3.10-3.14 plus the Python 3.15 release candidate, and PyPy3.10, and requires NumPy; upstream support for Python 3.10 is now deprecated as that version approaches end of life.
Two recent releases were driven by security fixes, and both matter for the parsing workflows below:
- 1.88 hardens the
Bio.NexusNEXUS parser. Up to 1.87 it read thentaxandncharvalues out of the file and passed them to Python's built-ineval, so those fields were executable and a crafted file could run arbitrary code at parse time. Both call sites are gone in 1.88.Bio.PhyloandBio.AlignIOshare this parser, so the exposure is not limited to code that importsBio.Nexusdirectly. - 1.87 addressed CVE-2025-68463 in
Bio.Entrez.Parserwhen parsing untrusted files.
Prefer 1.88+ for any workflow that parses NEXUS or Entrez XML it did not produce itself.
When to Use This Skill
Use this skill when:
- Working with biological sequences (DNA, RNA, or protein)
- Reading, writing, or converting biological file formats (FASTA, GenBank, FASTQ, PDB, mmCIF, etc.)
- Accessing NCBI databases (GenBank, PubMed, Protein, Gene, etc.) via Entrez
- Running BLAST searches or parsing BLAST results
- Performing sequence alignments (pairwise or multiple sequence alignments)
- Analyzing protein structures from PDB files
- Creating, manipulating, or visualizing phylogenetic trees
- Finding sequence motifs or analyzing motif patterns
- Calculating sequence statistics (GC content, molecular weight, melting temperature, etc.)
- Performing structural bioinformatics tasks
- Working with population genetics data
- Any other computational molecular biology task
Core Capabilities
Biopython is organized into modular sub-packages, each addressing specific bioinformatics domains:
- Sequence Handling - Bio.Seq and Bio.SeqIO for sequence manipulation and file I/O
- Alignment Analysis - Bio.Align and Bio.AlignIO for pairwise and multiple sequence alignments
- Database Access - Bio.Entrez for programmatic access to NCBI databases
- BLAST Operations - Bio.Blast for running and parsing BLAST searches
- Structural Bioinformatics - Bio.PDB for working with 3D protein structures
- Phylogenetics - Bio.Phylo for phylogenetic tree manipulation and visualization
- Advanced Features - Motifs, population genetics, sequence utilities, and more
Installation and Setup
Install the current stable Biopython release with an explicit version pin for reproducibility:
uv pip install "biopython==1.88"
For NCBI database access, always set your email address (required by NCBI). For reusable software, set a stable Entrez.tool value and register the tool/email with NCBI. For higher rate limits (10 req/s instead of 3 req/s), read only NCBI_API_KEY from the environment — do not hardcode keys or load unrelated environment variables:
import os
from Bio import Entrez
Entrez.email = "your.email@example.com" # required — use your real email
Entrez.tool = "your_tool_name" # optional but recommended for reusable software
# Optional: register at https://www.ncbi.nlm.nih.gov/account/settings/
if api_key := os.environ.get("NCBI_API_KEY"):
Entrez.api_key = api_key
Using This Skill
This skill provides comprehensive documentation organized by functionality area. When working on a task, consult the relevant reference documentation:
1. Sequence Handling (Bio.Seq & Bio.SeqIO)
Reference: references/sequence_io.md
Use for:
- Creating and manipulating biological sequences
- Reading and writing sequence files (FASTA, GenBank, FASTQ, etc.)
- Converting between file formats
- Extracting sequences from large files
- Sequence translation, transcription, and reverse complement
- Working with SeqRecord objects
Quick example:
from Bio import SeqIO
# Read sequences from FASTA file
for record in SeqIO.parse("sequences.fasta", "fasta"):
print(f"{record.id}: {len(record.seq)} bp")
# Convert GenBank to FASTA
SeqIO.convert("input.gb", "genbank", "output.fasta", "fasta")
2. Alignment Analysis (Bio.Align & Bio.AlignIO)
Reference: references/alignment.md
Use for:
- Pairwise sequence alignment (global and local)
- Reading and writing multiple sequence alignments
- Using substitution matrices (BLOSUM, PAM)
- Calculating alignment statistics
- Customizing alignment parameters
Quick example:
from Bio import Align
# Pairwise alignment
aligner = Align.PairwiseAligner()
aligner.mode = 'global'
alignments = aligner.align("ACCGGT", "ACGGT")
print(alignments[0])
3. Database Access (Bio.Entrez)
Reference: references/databases.md
Use for:
- Searching NCBI databases (PubMed, GenBank, Protein, Gene, etc.)
- Downloading sequences and records
- Fetching publication information
- Finding related records across databases
- Batch downloading with proper rate limiting
Quick example:
from Bio import Entrez
Entrez.email = "your.email@example.com"
# Search PubMed
handle = Entrez.esearch(db="pubmed", term="biopython", retmax=10)
results = Entrez.read(handle)
handle.close()
print(f"Found {results['Count']} results")
4. BLAST Operations (Bio.Blast)
Reference: references/blast.md
Use for:
- Running BLAST searches via NCBI web services
- Running local BLAST searches
- Parsing BLAST XML output
- Filtering results by E-value or identity
- Extracting hit sequences
Quick example:
from Bio.Blast import NCBIWWW, NCBIXML
# Run BLAST search
result_handle = NCBIWWW.qblast("blastn", "nt", "ATCGATCGATCG")
blast_record = NCBIXML.read(result_handle)
# Display top hits
for alignment in blast_record.alignments[:5]:
print(f"{alignment.title}: E-value={alignment.hsps[0].expect}")
5. Structural Bioinformatics (Bio.PDB)
Reference: references/structure.md
Use for:
- Parsing PDB and mmCIF structure files
- Navigating protein structure hierarchy (SMCRA: Structure/Model/Chain/Residue/Atom)
- Calculating distances, angles, and dihedrals
- Secondary structure assignment (DSSP)
- Structure superimposition and RMSD calculation
- Extracting sequences from structures
Quick example:
from Bio.PDB import PDBParser
# Parse structure
parser = PDBParser(QUIET=True)
structure = parser.get_structure("1crn", "1crn.pdb")
# Calculate distance between alpha carbons
chain = structure[0]["A"]
distance = chain[10]["CA"] - chain[20]["CA"]
print(f"Distance: {distance:.2f} Å")
6. Phylogenetics (Bio.Phylo)
Reference: references/phylogenetics.md
Use for:
- Reading and writing phylogenetic trees (Newick, NEXUS, phyloXML)
- Building trees from distance matrices or alignments
- Tree manipulation (pruning, rerooting, ladderizing)
- Calculating phylogenetic distances
- Creating consensus trees
- Visualizing trees
Quick example:
from Bio import Phylo
# Read and visualize tree
tree = Phylo.read("tree.nwk", "newick")
Phylo.draw_ascii(tree)
# Calculate distance
distance = tree.distance("Species_A", "Species_B")
print(f"Distance: {distance:.3f}")
7. Advanced Features
Reference: references/advanced.md
Use for:
- Sequence motifs (Bio.motifs) - Finding and analyzing motif patterns
- Population genetics (Bio.PopGen) - GenePop files, Fst calculations, Hardy-Weinberg tests
- Sequence utilities (Bio.SeqUtils) - GC content, melting temperature, molecular weight, protein analysis
- Restriction analysis (Bio.Restriction) - Finding restriction enzyme sites
- Clustering (Bio.Cluster) - K-means and hierarchical clustering
- Genome diagrams (GenomeDiagram) - Visualizing genomic features
Quick example:
from Bio.SeqUtils import gc_fraction, molecular_weight
from Bio.Seq import Seq
seq = Seq("ATCGATCGATCG")
print(f"GC content: {gc_fraction(seq):.2%}")
print(f"Molecular weight: {molecular_weight(seq, seq_type='DNA'):.2f} g/mol")
General Workflow Guidelines
Reading Documentation
When a user asks about a specific Biopython task:
- Identify the relevant module based on the task description
- Read the appropriate reference file using the Read tool
- Extract relevant code patterns and adapt them to the user's specific needs
- Combine multiple modules when the task requires it
Example search patterns for reference files:
# Find information about specific functions
rg -n "SeqIO.parse" references/sequence_io.md
# Find examples of specific tasks
rg -n "BLAST" references/blast.md
# Find information about specific concepts
rg -n "alignment" references/alignment.md
Writing Biopython Code
Follow these principles when writing Biopython code:
-
Import modules explicitly
from Bio import SeqIO, Entrez from Bio.Seq import Seq -
Set Entrez email when using NCBI databases; load only
NCBI_API_KEYfrom the environment if presentimport os from Bio import Entrez Entrez.email = "your.email@example.com" Entrez.tool = "your_tool_name" if api_key := os.environ.get("NCBI_API_KEY"): Entrez.api_key = api_key -
Use appropriate file formats - Check which format best suits the task
# Common formats: "fasta", "genbank", "fastq", "clustal", "phylip" -
Handle files properly - Close handles after use or use context managers
with open("file.fasta") as handle: records = SeqIO.parse(handle, "fasta") -
Use iterators for large files - Avoid loading everything into memory
for record in SeqIO.parse("large_file.fasta", "fasta"): # Process one record at a time print(record.id, len(record.seq)) -
Handle errors gracefully - Network operations and file parsing can fail
from urllib.error import HTTPError try: handle = Entrez.efetch(db="nucleotide", id=accession) except HTTPError as e: print(f"Error: {e}")
Common Patterns
Pattern 1: Fetch Sequence from GenBank
from Bio import Entrez, SeqIO
Entrez.email = "your.email@example.com"
# Fetch sequence
handle = Entrez.efetch(db="nucleotide", id="EU490707", rettype="gb", retmode="text")
record = SeqIO.read(handle, "genbank")
handle.close()
print(f"Description: {record.description}")
print(f"Sequence length: {len(record.seq)}")
Pattern 2: Sequence Analysis Pipeline
from Bio import SeqIO
from Bio.SeqUtils import gc_fraction
for record in SeqIO.parse("sequences.fasta", "fasta"):
# Calculate statistics
gc = gc_fraction(record.seq)
length = len(record.seq)
# Find ORFs, translate, etc.
protein = record.seq.translate()
print(f"{record.id}: {length} bp, GC={gc:.2%}")
Pattern 3: BLAST and Fetch Top Hits
from Bio.Blast import NCBIWWW, NCBIXML
from Bio import Entrez, SeqIO
Entrez.email = "your.email@example.com"
# Run BLAST
result_handle = NCBIWWW.qblast("blastn", "nt", sequence)
blast_record = NCBIXML.read(result_handle)
# Get top hit accessions
accessions = [aln.accession for aln in blast_record.alignments[:5]]
# Fetch sequences
for acc in accessions:
handle = Entrez.efetch(db="nucleotide", id=acc, rettype="fasta", retmode="text")
record = SeqIO.read(handle, "fasta")
handle.close()
print(f">{record.description}")
Pattern 4: Build Phylogenetic Tree from Sequences
from Bio import AlignIO, Phylo
from Bio.Phylo.TreeConstruction import DistanceCalculator, DistanceTreeConstructor
# Read alignment
alignment = AlignIO.read("alignment.fasta", "fasta")
# Calculate distances
calculator = DistanceCalculator("identity")
dm = calculator.get_distance(alignment)
# Build tree
constructor = DistanceTreeConstructor()
tree = constructor.nj(dm)
# Visualize
Phylo.draw_ascii(tree)
Best Practices
- Always read relevant reference documentation before writing code
- Use grep to search reference files for specific functions or examples
- Validate file formats before parsing
- Handle missing data gracefully - Not all records have all fields
- Cache downloaded data - Don't repeatedly download the same sequences
- Respect NCBI rate limits - Use API keys, registered tool/email values for reusable software, and Entrez history/batching for large jobs
- Test with small datasets before processing large files
- Keep Biopython updated to get the latest features, bug fixes, and security fixes — 1.87 and 1.88 were both driven by parser vulnerabilities
- Use appropriate genetic code tables for translation
- Document analysis parameters for reproducibility
Troubleshooting Common Issues
Issue: "No handlers could be found for logger 'Bio.Entrez'"
Solution: This is just a warning. Set Entrez.email to suppress it.
Issue: "HTTP Error 400" from NCBI
Solution: Check that IDs/accessions are valid and properly formatted.
Issue: "ValueError: EOF" when parsing files
Solution: Verify file format matches the specified format string.
Issue: Alignment fails with "sequences are not the same length"
Solution: Ensure sequences are aligned before using AlignIO or MultipleSeqAlignment.
Issue: BLAST searches are slow
Solution: Use local BLAST for large-scale searches, or cache results.
Issue: PDB parser warnings
Solution: Use PDBParser(QUIET=True) to suppress warnings, or investigate structure quality.
Issue: Bio.MarkovModel and Bio.Application raise ModuleNotFoundError, and Bio.HMM imports but is empty
Solution: The functionality was removed in Biopython 1.86. Use hmmlearn for HMMs and the standard library subprocess module instead of Bio.Application CLI wrappers.
Bio.MarkovModel and Bio.Application are gone outright, so importing either raises ModuleNotFoundError. Bio.HMM is the one that misleads: as of 1.88 it is still installed as a package containing nothing but its own docstring, so import Bio.HMM succeeds and an availability check written that way reports the module as present. Every submodule that did the work — Bio.HMM.MarkovModel, Bio.HMM.Trainer, Bio.HMM.Utilities, Bio.HMM.DynamicProgramming — raises ModuleNotFoundError. Test for what you actually call, not for the package.
Issue: Reading a NEXUS file from a source you do not control
Solution: Use Biopython 1.88 or later. Up to 1.87 the NEXUS parser passed the file's own ntax and nchar fields to Python's built-in eval, so reading a crafted file could run arbitrary code. Every NEXUS entry point shares that parser — Phylo.read(path, "nexus"), AlignIO.read(path, "nexus") and Bio.Nexus.Nexus alike — so upgrading, rather than switching entry point, is the fix.
Issue: PairwiseAligner returns fewer alignments after upgrading to 1.86+
Solution: The default gap score changed from 0 to -1 in 1.86, so a gap no longer ties with a mismatch and the trivial tie alignments disappear. It bites only where a gap competes with a mismatch: AAGAA against AACAA returns 1 alignment where it used to return 3. On a pair differing by a plain insertion it changes nothing — ACCGGT against ACGGT returns 2 alignments under either setting, which is why testing this on the usual tutorial pair suggests the change never happened. Set aligner.gap_score = 0 to restore the old behavior if needed (see references/alignment.md).
Try it
A self-contained check that this skill still works. No network, no account, no downloads — the block writes its own input, so it runs anywhere Biopython is installed.
Data — generated inline, which is why datasets: is empty. The block writes three short
sequences to demo.fasta and reads them back. AAGAA and AACAA are the pair that matters:
they differ at a single position, which is the only situation where the alignment default that
changed in 1.86 changes how many alignments come back. Nothing public needs to be fetched to
exercise this, and depending on a remote sequence file would make the check fail for reasons
that have nothing to do with Biopython.
Run
from Bio import Align, SeqIO
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio.SeqUtils import gc_fraction
# --- data: written here, nothing fetched -------------------------------------
records = [
SeqRecord(Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"), id="seq1", description=""),
SeqRecord(Seq("AAGAA"), id="seq2", description=""),
SeqRecord(Seq("AACAA"), id="seq3", description=""),
]
SeqIO.write(records, "demo.fasta", "fasta")
parsed = {r.id: r.seq for r in SeqIO.parse("demo.fasta", "fasta")}
print(f"parsed {len(parsed)} records: {sorted(parsed)}")
# --- sequence basics ---------------------------------------------------------
cds = parsed["seq1"]
print(f"gc_fraction = {gc_fraction(cds):.4f}")
print(f"translate = {cds.translate()}")
print(f"to_stop = {cds.translate(to_stop=True)}")
# --- the trap: the gap-score default changed in 1.86 -------------------------
target, query = str(parsed["seq2"]), str(parsed["seq3"])
current = Align.PairwiseAligner(mode="global")
legacy = Align.PairwiseAligner(mode="global")
legacy.gap_score = 0 # the pre-1.86 default
now, before = current.align(target, query), legacy.align(target, query)
print(f"default gap_score = {current.gap_score}")
print(f"{target}/{query}: {len(now)} alignment(s) now, {len(before)} at gap_score=0")
print(f"scores: {now.score} and {before.score}")
# the same comparison on the pair this skill uses as its quick example
a, b = Align.PairwiseAligner(mode="global"), Align.PairwiseAligner(mode="global")
b.gap_score = 0
print(f"ACCGGT/ACGGT: {len(a.align('ACCGGT', 'ACGGT'))} alignment(s) now, "
f"{len(b.align('ACCGGT', 'ACGGT'))} at gap_score=0")
# --- invariants --------------------------------------------------------------
assert len(cds) % 3 == 0 and len(cds.translate()) == len(cds) // 3
assert 0.0 <= gc_fraction(cds) <= 1.0
assert current.gap_score == -1.0
assert len(now) < len(before)
assert now.score == before.score
print("OK")
Expect
Invariants — these hold across versions, and a failure means the skill is wrong:
- One amino acid per complete codon: a 39-nt CDS gives 13 residues.
to_stop=Truetruncates at the first stop rather than dropping the stop symbols from the middle. gc_fractionreturns a fraction in 0–1, not a percentage. The:.2%format used in Pattern 2 above is what turns it into one; printing it raw and calling it a percentage is the mistake this asserts against.SeqIO.parseyields each record once — it is an iterator, not a list.- Where a mismatch and a pair of gaps score equally,
gap_score = 0keeps all of them and the current default keeps only the ungapped one. That survivor has no gaps, so its score is the same under both settings. Where the best alignment does contain gaps, the −1 default instead lowers its score by one per gap character and leaves the count alone.
Observed 2026-08-27 against Biopython 1.88 / Python 3.11.15 — treat a mismatch here as drift to investigate, not as a failure:
parsed 3 records: ['seq1', 'seq2', 'seq3']
gc_fraction = 0.5641
translate = MAIVMGR*KGAR*
to_stop = MAIVMGR
default gap_score = -1.0
AAGAA/AACAA: 1 alignment(s) now, 3 at gap_score=0
scores: 4.0 and 4.0
ACCGGT/ACGGT: 2 alignment(s) now, 2 at gap_score=0
OK
The last line is the part worth keeping. ACCGGT/ACGGT — the pair used as this skill's own
pairwise example, and the one in most tutorials — returns 2 alignments either way, so testing
the 1.86 change on it suggests the change never happened.
Additional Resources
- Official Documentation: https://biopython.org/docs/latest/
- Tutorial: https://biopython.org/docs/latest/Tutorial/
- Cookbook: https://biopython.org/docs/latest/Tutorial/ (advanced examples)
- GitHub: https://github.com/biopython/biopython
- Release notes: https://github.com/biopython/biopython/blob/master/NEWS.rst
- Deprecated APIs: https://github.com/biopython/biopython/blob/master/DEPRECATED.rst
- Mailing List: biopython@biopython.org
Quick Reference
To locate information in reference files, use these search patterns:
# Search for specific functions
rg -n "function_name" references/*.md
# Find examples of specific tasks
rg -n "example" references/sequence_io.md
# Find all occurrences of a module
rg -n "Bio.Seq" references/*.md
Summary
Biopython provides comprehensive tools for computational molecular biology. When using this skill:
- Identify the task domain (sequences, alignments, databases, BLAST, structures, phylogenetics, or advanced)
- Consult the appropriate reference file in the
references/directory - Adapt code examples to the specific use case
- Combine multiple modules when needed for complex workflows
- Follow best practices for file handling, error checking, and data management
The modular reference documentation ensures detailed, searchable information for every major Biopython capability.